Skip to main content
NCBI home page
Clinical and Experimental Immunology logoLink to Clinical and Experimental Immunology
. 2001 Jul;125(1):56–63. doi: 10.1046/j.1365-2249.2001.01588.x

Cooperation of interleukin-17 and interferon-γ on chemokine secretion in human fetal intestinal epithelial cells

A Andoh *, H Takaya *, J Makino *, H Sato †, S Bamba *, Y Araki *, K Hata *, M Shimada *, T Okuno *, Y Fujiyama *, T Bamba *
PMCID: PMC1906093  PMID: 11472426

Abstract

Interleukin (IL)-17 is a newly identified T cell-derived cytokine that can regulate the functions of a variety of cell types. In this study, we investigated the effects of IL-17 and interferon (IFN)-γ on chemokine secretion in human fetal intestinal epithelial cells. IL-8 and monocyte chemoattractant protein (MCP)-1 secretion by the human fetal intestinal epithelial cell line, intestine-407, was evaluated by ELISA and Northern blot. The expression of IL-17 receptor (R) was analysed by a binding assay using [125I]-labelled IL-17. The activation of nuclear factor-κB (NF-κB), NF-IL6 and AP‐1 was assessed by an electrophoretic gel mobility shift assay (EMSA). IL-17 induced a dose-dependent increase in IL-8 and MCP-1 secretion. The inducing effects of IL-17 on IL-8 and MCP-1 mRNA abundance reached a maximum as early as 3 h, and then gradually decreased. IL-17 and IFN-γ synergistically increased IL-8 and MCP-1 secretion and mRNA abundance. IFN-γ induced a weak increase in IL-17 R mRNA abundance, and incubation with IFN-γ for 24 h enhanced [125I]-labelled IL-17-binding by 2·4-fold. IL-17 rapidly induced the phosphorylation and degradation of IκBα molecules, and the combination of IL-17 and IFN-γ induced a marked increase in NF-κB DNA-binding activity as early as 1·5 h after the stimulation. Furthermore, this combination induced an increase in NF-IL-6 and AP-1 DNA-binding activity. In conclusion, it becomes clear that IL-17 is an inducer of IL-8 and MCP-1 secretion by human fetal intestinal epithelial cells. The combination of IL-17 with IFN-γ synergistically enhanced chemokine secretion. These effects of IL-17 and IFN-γ might play an important role in the inflammatory responses in the intestinal mucosa.

Keywords: IBD, IL-17 receptor, transcription factor

Introduction

Chemokines have a broad range of actions on the recruitment and function of specific populations of leucocytes at the site of inflammation. These factors play an important role in the initiation and maintenance of the host inflammatory response [1,2]. Chemokines are divided structurally into several groups by base on the presence of an intervening amino acid between the first two cysteine residues (e.g. C-X-C and C-C chemokines) [1,2]. The C-X-C chemokines act as chemoattractants and activators of neutrophils (e.g. interleukin (IL)-8), whereas the C-C chemokines function mainly as chemoattractants for monocytes, eosinophils, T cells and basophils (e.g. monocyte chemoattractant protein (MCP)-1). Although various chemokines are secreted by many different cell types such as monocytes/macrophages, neutrophils, lymphocytes, fibroblasts and endothelial cells [1,2], it has been reported that intestinal epithelial cells have an ability to produce chemokines in response to inflammatory cytokines such as IL-1β and tumour necrosis factor (TNF)-α [3].

IL-17 is a newly identified T cell-specific cytokine [4,5]. The human IL-17 is a ∼20-kDa glycoprotein of 155 amino acids, the sequence of which exhibits close homology to both cytotoxic T lymphocyte-associated antigen-8 (CTLA-8) and the open reading frame 13 of T-lymphotropic Herpesvirus saimiri (HVS-13). IL-17 secretion is strictly limited in activated CD4+ and CD8+ T lymphocytes, predominantly in the memory CD45RO+ cells [6–8]. In particular, both the Th1 and Th2 subsets of CD4+ cells release IL-17. On the other hand, IL-17 receptor (R) is widely distributed on various cell types [9,10], and there is increasing evidence that IL-17 is a potent mediator of inflammatory responses in various tissues. For example, IL-17 induces several genes associated with inflammation, including IL-6, granulocyte-colony stimulating factor (G-CSF), leukaemia inhibitory factor (LIF) and intercellular adhesion molecule (ICAM)-1 [11–16].

Inflammatory bowel diseases (IBD), such as ulcerative colitis (UC) and Crohn's disease (CD), are characterized by the recurrent flare of inflammation on chronic enterocolitis. The activation of T cells has been regarded as an important factor in the pathogenesis of IBD [17–20], and the T cell-rich infiltrate in the mucosa is characteristic of the chronic phase. The mechanisms mediating the flare of acute response (e.g. neutrophil infiltration) in IBD remain unclear.

A primary function of T cells is the release of cytokines which regulate the magnitude and duration of both immune and inflammatory responses. IL-2, IFN-γ and TNF-α released by CD4+ and CD8+ T cells have proinflammatory effects, whereas IL-4 and IL-10 released by CD4+ Th2 cells block these responses [14]. In the induction of acute responses during the chronic phase in IBD patients, INF-γ and TNF-α have been identified as factors which amplify inflammation by stimulating resident mucosal cells to secrete chemokines that attract immune and inflammatory cells [19,20].

In this study, we set out to investigate the potential role of IL-17 in the induction of inflammatory responses in the intestinal mucosa. In particular, we focused on the interaction between IL-17 and IFN-γ in the induction of IL-8 and MCP-1 secretion by intestinal epithelia cells. The observations in this study indicate that T cells play an important role in the inflammatory responses in the intestine through the secretion of IL-17 and IFN-γ.

Materials and methods

Reagents

Recombinant human IL-17 and IFN-γ were obtained from R&D Systems (Minneapolis, MN, USA). All other reagents used in this study were purchased from Sigma Chemical Co. (St Louis, MO, USA).

Cells

The intestine-407 cells were obtained from the American Type Culture Collection (ATCC, Rockville, MD, USA). This cell line was established from the small intestine of human fetus [21], retain a normal karyotype (data from ATCC) and exhibit typical epithelial morphology and growth. The cells are used as a model of normal intestinal epithelial cells in vitro [22,23]. The cells were cultured as a monolayer and maintained in Dulbecco's modified Eagle's medium (DMEM: Gibco Laboratories, Grand Island, NY, USA) containing 10% fetal bovine serum (FBS; Gibco), 5 × 104 U/l penicillin and 50 µg/l streptomycin. The cells were seeded at a density of 2·5 × 105 cells/ml, and cell culture media was changed every third day. All experiments were performed after cells had achieved confluence.

Quantification of human chemokines

The amounts of antigenic IL-8 and MCP-1 in the samples were determined by sandwich enzyme-linked immunosorbent assay (ELISA) kits purchased from Bio-Source (Camarillo, CA, USA).

Northern blot analysis

Total cellular RNA was isolated by the acid guanidinium thiocyanate–phenol–chloroform method [24]. Northern blot was performed according to methods described previously [25]. The hybridization was performed with [32P]-labelled human IL-8 and MCP-1 probe, generated by a random primed DNA labelling kit (Amersham, Arlington Heights, IL, USA), and evaluated by autoradiography. The human chemokine cDNA probe was prepared from a monolayer of human umbilical vein endothelial cells by a reverse-transcription polymerase chain reaction (RT-PCR) method using primers: IL-8 (5′: ACATGACTTC CAAGCTGGCC corresponding to nucleotides 101–121 isolated by Matsushima et al. [26], and 3′: TTTTATGA ATTCCAGCCCT corresponding to nucleotides 404–385), MCP-1 (5′: ATGAAAGTCTCTGC-CGCCCTTCT corresponding to nucleotides 1–24 isolated by Yoshimura et al. [27], and 3′: TGAGTGTT CAAGTCTTCGGAGTT corresponding to nucleotides 299–278), and IL-17 R (5′: TGAAGGTAA-CCACGCCATGCAT corresponding to nucleotides 601–622 isolated by Schall et al. [9], and 3′: TCGGCTGAGTAGATGATCCAGA coresponding to nucleotides 1192–1171). The PCR products were ligated into the TA cloning vector (Promega, Madison, WI, USA) and sequenced by the dideoxynucleotide chain termination method [28].

Radioiodination of recombinant IL-17 and binding assay

Recombinant human IL-17 was labelled with 1 mCi of [125NaI] by the Iodo-Gen method (Pierce, Rockford, IL, USA). Intestine-407 cells were cultured in 6-well plates and cultured for 24 h in the presence or absence of IFN-γ (200 U/ml). Non-specific binding of [125I]-IL-17 was determined by the count in the presence of a 500-fold excess of cold IL-17.

Nuclear extracts and electrophoretic gel mobility shift assays

Nuclear extracts were prepared from intestine-407 cells exposed to IL-17 (500 ng/ml) and IFN-γ (200 U/ml) for 1·5 h by the method of Dignam and Roeder [29–31]. Consensus oligonucleotides of NF-κB (5′: AATCGTGGAATTT-CCTCTGACA) [32], NF-IL6 (TGCAGATTGCGCAATCTGCA) [33] and AP-1 (c-jun: 5′-CGCTTG ATG AGTCAGCCGGAA) [34–39] were used. The consensus sequence for binding of transcription factor was underlined. Oligonucleotides were 5′ end-labelled with T4 polynucleotide kinase (Promega, Madison, WI, USA) and [γ32P]ATP (Amersham). Binding reactions were performed according to methods described previously. Supershift experiments were performed as described above except that 1 µl of antibody to each transcription factor was added to the binding mixture in the absence of labelled probe. Antisera specifically recognizing each transcriptional factor were purchased from Santa Cruz Biotechnology Inc. (Santa Cruz, CA, USA). Experiments with unlabelled oligonucleotides used a 100-fold molar excess relative to the radiolabelled oligonucleotide.

Results

Induction of chemokine secretion by IL-17

Intestine-407 cells were incubated with increasing concentrations of IL-17, and IL-8 and MCP-1 levels in supernatants were determined by ELISA. As shown in Fig. 1, the addition of IL-17 induced a dose-dependent increase in IL-8 and MCP-1 secretion. The induction of chemokine secretion was clearly detectable at an IL-17 concentration of 100 ng/ml. When comparing the effects of IL-17 with those induced by IL-1β or TNF-α, the effects of IL-17 were relatively modest; IL-1β (50 ng/ml) induced 6·8 ± 3·5 ng IL-8/106 cells and 8·0 ± 2·4 ng MCP-1/106 cells, and TNF-α (100 ng/ml) induced 10·1 ± 4·6 ng IL-8/106 cells and 9·6 ± 3·4 ng MCP-1/106 cells, respectively.

Fig. 1.

Fig. 1

Open in a new tab

Effects of IL-17 on IL-8 and MCP-1 secretion in intestine 407 cells. The cells were incubated for 48 h in the presence of increasing concentrations of IL-17. The amounts of IL-8 and MCP-1 were determined by ELISA. Values were expressed as mean±SD (n = 4).

The effects of IL-17 on IL-8 and MCP-1 mRNA abundance in intestine-407 cells were also investigated. Cells were incubated with IL-17 (500 ng/ml), and IL-8 and MCP-1 mRNA levels were successively determined by Northern blotting (Fig. 2a). IL-17 induced a rapid increase in chemokine mRNA abundance at as early as 1 h, and this reached a peak at 3 h. Induced-IL-8 and MCP-1 mRNA abundance then gradually decreased. As demonstrated in Fig. 2b,c, IL-17 induced a rapid secretion of IL-8 and MCP-1 as early as 12 h, and this then became slower.

Fig. 2.

Fig. 2

Open in a new tab

(a) Kinetics of IL-17-induced increase in IL-8 and MCP-1 mRNA abundance in intestine-407 cells. Intestine-407 cells were stimulated with IL-17 (500 ng/ml), and the abundance of IL-8 and MCP-1 mRNA was sequentially determined by Northern blotting. (b) Kinetics of IL-17-induced increase in IL-8 (b) and MCP-1. (c) Secretion in intestine-407 cells. Intestine-407 cells were stimulated with IL-17 (500 ng/ml), and the amounts of IL-8 and MCP-1 in supernatants were determined by ELISA. •, data of IL-17; ○, data of medium only. Values were expressed as mean±SD (n = 4).

Effects of IL-17 in combination with IFN-γ on chemokine secretion

Intestine-407 cells were stimulated with IL-17 (500 ng/ml), IFN-γ (200 U/ml) or IL-17 plus IFN-γ. As shown in Fig. 3a,b, IFN-γ induced a marked increase in MCP-1 secretion, whereas IFN-γ did not affect IL-8 secretion. However, the combination of IL-17 and IFN-γ induced a marked increase in both IL-8 and MCP-1 secretion. These effects were also observed at the level of mRNA (Fig. 3c,d). Intestine-407 cells were stimulated with IL-17, IFN-γ, or IL-17 plus IFN-γ for 3 h, and IL-8 and MCP-1 mRNA abundance was determined by Northern blotting. IFN-γ induced a rapid increase in MCP-1 mRNA abundance, but its effect on IL-8 mRNA abundance was relatively modest. However, the combination of IL-17 and IFN-γ induced a marked increase in IL-8 and MCP-1 mRNA abundance in intestine-407 cells. These results were compatible with the observations at protein levels.

Fig. 3.

Fig. 3

Open in a new tab

Effects of IFN-γ on IL-17-induced secretion of IL-8 (a) and MCP-1 (b). Intestine-407 cells were incubated for 48 h in the presence or absence of IL-17 (500 ng/ml), IFN-γ (200 U/ml), or IL-17 (500 ng/ml) plus IFN-γ (200 U/ml). The amounts of IL-8 and MCP-1 were determined by ELISA. Values were expressed as mean±SD (n = 4). Northern analysis of the effects of IL-17 and IFN-γ on IL-8 (c) and MCP-1 (d) mRNA abundance in intestine-407 cells. The cells were incubated for 3 h in the presence or absence of IL-17 (500 ng/ml), IFN-γ (200 U/ml), or IL-17 (500 ng/ml) plus IFN-γ (200 U/ml), and then Northern blotting was performed. The same membrane was used for the determination of IL-8 and MCP-1 mRNA expression.

Induction of IL-17 receptor (R) expression by IFN-γ

The induction of TNF-α receptor (R) expression by IFN-γ has been reported [40], and this has been regarded as one of the mechanisms mediating the synergistic effects of TNF-α plus IFN-γ on chemokine secretion. To define the role of similar mechanisms in effects combined of IL-17 and IFN-γ, we evaluated the effects of IFN-γ on IL-17 R expression in intestine-407 cells. As shown in Fig. 4, IFN-γ induced a weak increase in IL-17 R mRNA abundance as early as 3 h, and this effect persisted for 12 h the binding assay using [125I]-labelled IL-17 revealed that treatment with IFN-γ for 24 h induced an approximately two-fold increase in IL-17 binding (Table 1). These observations indicate that IL-γ weakly induces IL-17 R expression in this cell line.

Fig. 4.

Fig. 4

Open in a new tab

Kinetics of IL-17 receptor (R) mRNA abundance in intestine-407 cells. The cells were incubated in the presence of IL-17 (500 ng/ml), and IL-17 R mRNA abundance was sequentially determined by Northern blotting.

Table 1.

Effects of IFN−γ on [125]-labelled IL-17 binding in intestine 407 cells

Specific bound* (×104 cpm) Specific bound/cell (×10−8 ng/cell)
Medium 6·32±2·23 1·90±0·67
Incubated with IFN-γ 15·56±3·04 4·61±0·96
Open in a new tab
*

Specific bound =(total bound) - (non-specific bound). Specific activity of [125I]-labelled IL-17 was 4·0 × 105 cpm/ng.

Modulation of transcription factor activation

The importance of transcription factor activation in the regulation of many genes has been reported. In particular, the expression of several genes, including IL-8 and MCP-1, is regulated by the activation of specific transcription factors such as NF-κB, NF-IL6 and AP-1 [32–38]. To elucidate the mechanisms underlying the response to IL-17, we evaluated activation of the transcription factors NF-κB, NF-IL6 and AP-1 in intestine-407 cells. As demonstrated in Fig. 5a, stimulation with IL-17 (500 ng/ml) for 1·5 h induced a weak increase in NF-κB-DNA binding activity (lane 2), whereas IFN-γ (200 U/ml) had no effects (lane 3). However, the combination of IL-17 and IFN-γ induced a marked increase in NF-κB-DNA binding activity (lane 4). The specificity of this reaction was confirmed by the addition of cold oligo-DNA, which abolished the reactive band (lane 5). The addition of antibody directed against a 65 000 MW-subunit (p65) of NF-κB induced a complete supershift of the binding complexes (lane 7), whereas the antibody against a 50 000 MW-subunit (p50) induced a weak reaction. Thus, these findings indicate that the major binding complex was a homodimer consisting of p65 subunits. We also tested the effects of IL-17 and IFN-γ on NF-IL6 DNA-binding activity (Fig. 6b). IL-17 did not affect NF-IL6 DNA binding activity, whereas IFN-γ increased NF-IL6 DNA binding activity. The combination of IL-17 plus IFN-γ further enhanced this reaction. The specificity of this binding was also confirmed; the reactive band disappeared following the addition of a cold probe. Concerning AP-1 activation, IL-17, but not IFN-γ, enhanced AP-1 DNA-binding activity (Fig. 6c). In addition, IFN-γ weakly enhanced IL-17-induced AP-1 DNA-binding activity. Based on these observations, we concluded that NF-κB, NF-IL6 and AP-1 activation plays a role in IL-17 and IFN-γ-induced enhancement of chemokine mRNA expression in intestine-407 cells.

Fig. 5.

Fig. 5

Open in a new tab

Electrophoretic gel mobility shift assays (EMSA) for NF-κB (a), NF-IL6 (b) and AP-1 (c) DNA-binding activities. The cells were incubate with medium alone, IL-17 (500 ng/ml), IFN-γ (200 U/ml) or IL-17 (500 ng/ml) plus IFN-γ (200 U/ml) for 1·5 h, and then nuclear extracts were prepared. Lane 1, medium alone; lane 2, IL-17; lane 3, IFN-γ; lane 4, IL-17 plus IFN-γ; lane 5, IL-17 plus cold probe; lane 6, IL-17 plus antip50 antibody; lane 7, IL-17 plus antip65 antibody and (c) lane 1, medium alone; lane 2, IL-17; lane 3, IFN-γ; lane 4, IL-17 plus IFN-γ; lane 5, IL-17 plus cold probe. NS at the right side means non-specific band.

Fig. 6.

Fig. 6

Open in a new tab

Western blot analysis for IκBα degradation. The cells were stimulated with IL-17 (500 ng/ml), and then total IκBα molecules (lower lane) and phosphorylated IκBα molecules (upper lane) were sequentially analysed by Western blotting.

Degradation of IκBα molecules

NF-κB activation is regulated by its cytoplasmic association with IκB molecules, which mask the nuclear localization signal of NF-κB [35]. In most cells, IκBα is the predominant inhibitory molecule, and the activation and translocation of NF-κB into the nucleus is contingent upon its release from IκBα. Numerous stimuli, including IL-1β and TNF-α, rapidly induce the phosphorylation and proteolytic degradation of IκBα and the consequent activation of NF-κB. To confirm the activation of IκBα molecules by IL-17 in intestine-407 cells, we assessed the activation of IκBα molecules. As demonstrated in Fig. 6, IL-17 induced phosphorylation of IκBα molecules as early as 15 min, and a decrease in total IκBα molecules was subsequently observed.

Discussion

The present study demonstrated an important role for IL-17 and IFN-γ in the regulation of chemokine secretion by human fetal intestinal epithelial cells. Combined stimulation leads to synergistic effects on IL-8 and MCP-1 secretion. Since both IL-17 and IFN-γ are products of activated T cells, these observations indicate that T cells play an important role in inflammatory responses in the intestine.

Intestinal epithelial cells play an important role in the first line of defence [30]. The primary role of the intestinal epithelial cells is to act as a physical barrier, separating the contents of a harsh luminal environment from the layers of tissue composing the internal milieu. Several lines of evidence have recently indicated that the intestinal epithelial cells also serve as active participants in various immunological functions. Several studies have revealed the ability of intestinal epithelial cells to secrete chemokines, such as IL-8, MCP-1, epithelial neutrophil-activating peptide (ENA) 78 and macrophage inflammatory protein (MIP)-1 [3,30]. Intestinal epithelial cells express elevated chemokine mRNA levels during the development of colitis in IL-2-deficient mice [31]. Under conditions which promote infection or insult to the epithelial monolayer, these chemokines, derived from intestinal epithelial cells, promote a rapid influx of immune and inflammatory cells into the mucosa within hours. Because most of these chemokines are specific for a certain cell type, the ratio and concentration of the different chemokines will determine the composition of the cell infiltrate [1,2]. Previous studies have focused primarily on the role of cytokines secreted by monocytes/macrophages. For example, IL-1β, IL-6 and TNF-α, which are mainly produced by monocytes/macrophages, have been established as potent stimulators of chemokine secretion in intestinal epithelial cells. However, the exact role of IL-17, a cytokine derived from T cells, remains unclear.

The induction of chemokine secretion by IL-17 has been previously reported in rodent intestinal epithelial cells [16]. However, human intestinal epithelial cells have not been previously studied. Here, we report that IL-17 and IFN-γ synergistically induce IL-8 and MCP-1 secretion by human intestinal epithelial cells. Similar synergistic effects of IL-17 and IFN-γ have been previously reported in other cell types. For example, IL-17 and IFN-γ synergistically up-regulate GM-CSF, GRO-α and IL-6 secretion in human keratinocytes [7]. To our knowledge, this is the first report describing the synergistic effects of IL-17 and IFN-γ on chemokine secretion in human intestinal epithelial cells. These observations suggest an important role for IL-17 in the induction of inflammatory responses in the intestinal mucosa.

T cell activation has been reported to play an important role in the pathogenesis of IBD [19,20]. Infiltration of T cells is a characteristic feature of chronic inflammation in IBD, and neutrophil infiltration becomes prominent in accordance with the progress of disease activity. The synergistically induced IL-8 and MCP-1 secretion by intestinal epithelial cells in response to IL-17 and IFN-γ emphasizes the important role of T-cell products in the induction of acute responses during chronic inflammation in the intestine. Elevated production of chemokines leads to further attraction of inflammatory cells and hence an amplification of the acute response. It is thought that the chronic inflammation in IBD patients is predominantly driven by Th1 immune responses [19,20]. Furthermore, expression of IFN-γ is restricted to Th1 cells, and IL-17 is secreted by both Th1 and Th2 cells. Therefore, the combined effects of Il-17 and IFN-γ might play a prominent role in the Th1-mediated ‘acute on chronic’ inflammation in IBD. The exact role of IL-17 in the pathogenesis of IBD should be evaluated further in future.

The promoter regions of the human IL-8 and MCP-1 genes have previously been cloned, sequenced and shown to contain putative consensus binding motifs for the transcription factor NF-κB, NF-IL6 and AP-1 [32–38]. NF-κB is important in the transcriptional activation of genes encoding the proteins that participate in the inflammatory and immune responses [32]. NF-κB activation is regulated by its cytoplasmic association with IκB molecules, which mask the nuclear localization signal of NF-κB [32,35]. In most cells IκBα is the predominant inhibitory molecule, and the activation and translocation of NF-κB into the nucleus is contingent upon its release from IκBα. Previous reports have shown NF-κB activation by IL-17 in several cell types [14,16]. Furthermore, it has been shown that the signal transduction events triggered by IL-17 which induce NF-κB activation involve MAP kinase activation downstream of TRAF6 [16]. Our results demonstrated that the activation of NF-κB was induced by IL-17, and this induction was associated with IκBα phosohorylation and degradation. More interestingly, the combination of IL-17 and IFN-γ induced a marked increase in NF-κB DNA-binding activity. Similar results were also observed in AP-1 DNA binding activity. On the other hand, IL-17 did not affect NF-IL6 DNA binding activity, whereas IFN-γ induced an increase in NF-IL6 DNA-binding activity. The induction of NF-IL6 DNA binding activity by IFN-γ has recently been reported [39], but there are no reports of how IL-17 modulates NF-IL6 and AP-1 DNA-binding activity. Our results suggest that IL-17 and IFN-γ enhanced IL-8 and MCP-1 mRNA expression and secretion through synergistic effects on NF-κB, NF-IL-6 and AP-1 DNA binding activity.

The detail of mechanisms mediating the synergism between IL-17 and IFN-γ remains unclear. In this study we tested the possibility that IFN-γ modulates IL-17R expression in intestine-407 cells, since several reports have shown that IFN-γ induces the up-regulation of TNF-α R expression and enhances the inflammatory effects of TNF-α [40]. The addition of IFN-γ weakly induced an increase in IL-17R mRNA abundance, and the incubation for 24 h significantly increased IL-17 binding activity by two-fold. However, the synergistic effect of IL-17 and IFN-γ on NF-κB activation was observed as early as 1·5 h. This rapid induction of NF-κB binding activity indicates that the synergistic effect of IL-17 and IFN-γ on chemokine secretion is not regulated at the level of IL-17R expression. It is likely that other mechanisms, such as the convergence of intracellular pathways, may contribute to this process. For example, how IL-17 affect IFN-γ-induced STAT1 activation in this cell line should be further defined, because studies with a variety of human cell types have demonstrated that TNF-α and IFN-γ coregulate in a synergistic manner the expression of many inflammatory genes via the independent activation of two distinct transcription factor NF-κB and STAT-1 [41]. Further investigations will be required to define the exact mechanisms mediating the synergistic effects of IL-17 and IFN-γ.

In conclusion, T-cell derived IL-17 and IFN-γ synergistically increase chemokine IL-8 and MCP-1 secretion by intestinal epithelial cells. These observations reinforce the concept that T-cell derived cytokines can collaborate in the promotion and shaping of inflammatory responses in the intestinal mucosa.

Acknowledgments

This study was supported in part by a Grant-in-Aid for Scientific Research from the Ministry of Education, Science, and Culture, Japan (12470121).

References

  • 1.Miller MD, Krangel MS. Biology and biochemistry of the chemokines: a family of chemotactic and inflammatory cytokines. Crit Rev Immunol. 1992;12:17–46. [PubMed] [Google Scholar]
  • 2.Baggiolimi M, Dewald B, Moser B. Interleukin-8 and related chemotactic cytokines-CXC and CC chemokines. Adv Immunol. 1994;55:97–179. [PubMed] [Google Scholar]
  • 3.Eckmann L, Jung HC, Schurer-Maly C, et al. Differential cytokine expression by human intestinal epithelial cell line: regulated expression of interleukin 8. Gastroenterology. 1993;105:1689–97. doi: 10.1016/0016-5085(93)91064-o. [DOI] [PubMed] [Google Scholar]
  • 4.Fossiez F, Banchereau J, Murry R, van Kooten C, Garrone P, Lebecque S. Interleukin-17. Intern Rev Immunol. 1998;16:541–51. doi: 10.3109/08830189809043008. [DOI] [PubMed] [Google Scholar]
  • 5.Yao Z, Painter SL, Fanslow WC, et al. Human IL-17: a novel cytokine derived from T cells. J Immunol. 1995;155:5483–6. [PubMed] [Google Scholar]
  • 6.Kennedy J, Rossi DL, Zurawski SM, et al. Mouse IL-17: a cytokine preferentially expressed by αβ TCR+ CD4–CD8− T cells. J Interferon Cytokine Res. 1996;16:611–7. doi: 10.1089/jir.1996.16.611. [DOI] [PubMed] [Google Scholar]
  • 7.Albanesi C, Scarponi C, Cavani A, Federici M, Nasorri F, Girolomoni G. Interleukin-17 is produced by both Th1 and Th2 lymphocytes, and modulates interferon-γ- and interleukin-4-induced activation of human keratinocytes. J Invest Dermatol. 2000;115:81–7. doi: 10.1046/j.1523-1747.2000.00041.x. [DOI] [PubMed] [Google Scholar]
  • 8.Shin HC, Benbernou N, Esnault S, Guenounou M. Expression of IL-17 in human memory CD45RO+ T lymphocytes and its regulation by protein kinase A pathway. Cytokine. 1999;11:257–66. doi: 10.1006/cyto.1998.0433. [DOI] [PubMed] [Google Scholar]
  • 9.Yao Z, Spriggs MK, Derry JM, et al. Molecular characterization of the human interleukin (IL) -17 receptor. Cytokine. 1997;9:794–800. doi: 10.1006/cyto.1997.0240. [DOI] [PubMed] [Google Scholar]
  • 10.Yao Z, Fanslow WC, Seldin MF, et al. Herpesvirus Saimiri encodes a new cytokine, IL-17, which bind to a novel cytokine receptor. Immunity. 1995;3:811–21. doi: 10.1016/1074-7613(95)90070-5. [DOI] [PubMed] [Google Scholar]
  • 11.Fossiez F, Djossou O, Chomarat P, et al. T cell interleukin-17 induces stromal cells to produce proinflammatory and hematopoietic cytokines. J Exp Med. 1996;183:2593–603. doi: 10.1084/jem.183.6.2593. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Chabaud M, Fossiez F, Taupin JL, Miossec P. Enhancing effects of IL-17 on IL-1-induced IL-6 and leukemia inhibitory factor production by rheumatoid arthritis synoviocytes and its regulation by Th2 cytokines. J Immunol. 1998;161:409–14. [PubMed] [Google Scholar]
  • 13.Cai XY, Gommol CPJ, Justice L, Narula SK, Fine JS. Reglation of granulocyte colony-stimulating factor gene expression by interleukin-17. Immunol Lett. 1998;62:51–8. doi: 10.1016/s0165-2478(98)00027-3. [DOI] [PubMed] [Google Scholar]
  • 14.Jovanovic DV, Di Battista JA, Martel PJ, et al. IL-17 stimulates the production and expression of proinflammatory cytokines, IL-1β and TNF-α, by human macrophages. J Immunol. 1998;60:3513–21. [PubMed] [Google Scholar]
  • 15.Albanesi C, Cavani A, Girolomoni G. IL-17 is produced by nickel-specific T lymphocytes and regulates ICAM-1 expression and chemokine production in human keratinocytes: synergistic or antagonist effects with IFN-γ and TNF-α. J Immunol. 1999;162:494–502. [PubMed] [Google Scholar]
  • 16.Awane M, Andres PG, Li DJ, Reinecker HC. NF-κB-inducing kinase is a common mediator of IL-17-, TNF-α-, and IL-1β-induced chemokine promoter actiation in intestinal epithelial cells. J Immunol. 1999;162:5337–44. [PubMed] [Google Scholar]
  • 17.Boirivant M, Marini M, DiFelice G, et al. Lamina propria T cells in Crohn's disease and other gastrointestinal inflammation show defective CD2 pathway-induced apoptosis. Gastroenterology. 1999;116:557–65. doi: 10.1016/s0016-5085(99)70177-0. [DOI] [PubMed] [Google Scholar]
  • 18.Saubermann LJ, Probert CSJ, Christ AD, et al. Evidence of T cell receptor β-chain patterns in inflammatory and noninflammatory bowel disease states. Am J Physiol. 1999;276:G613–G21. doi: 10.1152/ajpgi.1999.276.3.G613. [DOI] [PubMed] [Google Scholar]
  • 19.Kam LY, Targan SR. Cytokine-based therapies in inflammatory bowel disease. Curr Opin Gastroenterol. 1999;15:302–7. doi: 10.1097/00001574-199907000-00005. [DOI] [PubMed] [Google Scholar]
  • 20.Dohi T, Fujihashi K, Kiyono H, Elson CO, McGhee JR. Mice deficient in Th1- and Th2-type cytokines develop distinct forms of hapten-induced colitis. Gastroenterology. 2000;119:724–33. doi: 10.1053/gast.2000.16500. [DOI] [PubMed] [Google Scholar]
  • 21.Henle G, Deinhardt F. The establishment of strains of human cells in tissue culture. J Immunol. 1957;79:54–9. [PubMed] [Google Scholar]
  • 22.Kawanishi M. The Epstein–Barr virus latent membrane protein 1 (LMP1) enhances TNF-α-induced apoptosis of intestine 407 epithelial cells: the role of LMP1 C-terminal activation regions 1 and 2. Virology. 2000;270:258–66. doi: 10.1006/viro.2000.0296. [DOI] [PubMed] [Google Scholar]
  • 23.Andoh A, Takaya H, Araki y Tsujikawa T, Fujiyama Y, Bamba T. Medium- and long-chain fatty acids differentially modulate interleukin-8 secretion in human fetal intestinal epithelial cells. J Nutr. 2000;130:2636–40. doi: 10.1093/jn/130.11.2636. [DOI] [PubMed] [Google Scholar]
  • 24.Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 1987;162:156–9. doi: 10.1006/abio.1987.9999. [DOI] [PubMed] [Google Scholar]
  • 25.Andoh A, Takaya H, Saotome T, et al. Cytokine regulation of chemokine (IL-8, MCP-1, and RANTES) gene expression in human pancreatic periacinar myofibroblasts. Gastroenterology. 2000;119:211–9. doi: 10.1053/gast.2000.8538. [DOI] [PubMed] [Google Scholar]
  • 26.Matsushima K, Morishita K, Yoshimura T, et al. Molecular cloning of a human monocyte-derived neutrophil chemotactic factor (MDNCF) and the induction of MDCF mRNA by interleukin 1 and tumor necrosis factor. J Exp Med. 1988;167:1883–93. doi: 10.1084/jem.167.6.1883. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Yoshimura T, Yuhki N, Moore SK, Appella E, Lerman MI, Leonald EJ. Human monocyte chemoattractant protein-1 (MCP-1). Full-length cDNA cloning, expression in mitogen-stimulated blood mononuclear leukocytes, and sequence similarity to mouse competence gene JE. FEBS Lett. 1989;244:487–93. doi: 10.1016/0014-5793(89)80590-3. [DOI] [PubMed] [Google Scholar]
  • 28.Sanger F, Nicklen S, Coulson AR. DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA. 1977;74:5463–7. doi: 10.1073/pnas.74.12.5463. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Dignam JP, Lebovitz RM, Roeder RG. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucl Acids Res. 1983;11:1475–89. doi: 10.1093/nar/11.5.1475. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Pitman RS, Blumberg RS. First line of defence: the role of the intestinal epithelium as an active component of the mucosal immune system. J Gastroenterol. 2000;35:805–14. doi: 10.1007/s005350070017. [DOI] [PubMed] [Google Scholar]
  • 31.Meijssen MA, Brandwein SL, Reinecker HC, Bhan AK, Podolsky DK. Alteration of gene expression by intestinal epithelial cells precedes colitis in interleukin-2 deficient mice. Am J Physiol. 1998;274:G472–9. doi: 10.1152/ajpgi.1998.274.3.G472. [DOI] [PubMed] [Google Scholar]
  • 32.Kim J, Sanders SP, Siekierski ES, Casolaro V, Proud D. Role of NF-κB incytokine production induced from human airway epithelial cells by rhinovirus infection. J Immunol. 2000;165:3384–92. doi: 10.4049/jimmunol.165.6.3384. [DOI] [PubMed] [Google Scholar]
  • 33.Akira S, Isshiki H, Sugita T, et al. A nuclear factor for IL-6 expression (NF-IL6) is a member of a C/EBP family. EMBO J. 1990;9:1897–906. doi: 10.1002/j.1460-2075.1990.tb08316.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Bohmann D, Bos TJ, Admon A, et al. Human proto-oncogene c-jun encodes a DNA binding protein with structural and functional properties of transcriptional factor AP-1. Science. 1987;238:1386–92. doi: 10.1126/science.2825349. [DOI] [PubMed] [Google Scholar]
  • 35.Finco TS, Baldwin AS. Mechanistic aspects of NF-κB regulation: the emerging role of phosphorylation and proteolysis. Immunity. 1995;3:263–72. doi: 10.1016/1074-7613(95)90112-4. [DOI] [PubMed] [Google Scholar]
  • 36.Kunsh C, Lang RK, Rosen CA, Shannon MF. Synergistic transcriptional activation of the IL-8 gene by NF-kappa B p65 (RelA) and NF-IL6. J Immunol. 1994;153:153–64. [PubMed] [Google Scholar]
  • 37.Martin T, Cardarelli PM, Parry GC, Felts KA, Cobb RR. Cytokine induction of monocyte chemottractant protein-1 gene expression in human endothelial cells depends on the cooperative action of NF-κB and AP-1. Eur J Immunol. 1997;27:1091–7. doi: 10.1002/eji.1830270508. [DOI] [PubMed] [Google Scholar]
  • 38.Yasumoto K, Okamoto S, Mukaida N, Murakami S, Mai M, Matsushima K. Tumor necrosis factor α and interferon γ synergistically induce interleukin 8 production in a human gastric cancer cell line through acting concurrently on AP-1 and NF-κB-like binding sites of the interleukin 8 gene. J Biol Chem. 1992;267:22506–11. [PubMed] [Google Scholar]
  • 39.Roy SK, Wachira SJ, Weihua X, Hu J, Kalvakolanu DV. CCAAT/enhancing-binding protein-β regulates interferon-induced transcription through a novel element. J Biol Chem. 2000;275:12626–32. doi: 10.1074/jbc.275.17.12626. [DOI] [PubMed] [Google Scholar]
  • 40.Ruggiero V, Tavernier J, Fiers W, Baglioni C. Induction of the synthesis of tumor necrosis factor receptors by interferon-γ. J Immunol. 1986;136:2445–50. [PubMed] [Google Scholar]
  • 41.Ohmori Y, Schreiber RD, Hamilton TA. Synergy between IFN-γ and TNF-α in transcriptional activation is mediated by cooperation between signal transducer and activator of transcription 1 and nuclear factor κB. J Biol Chem. 1997;272:14899–907. doi: 10.1074/jbc.272.23.14899. [DOI] [PubMed] [Google Scholar]

Articles from Clinical and Experimental Immunology are provided here courtesy of British Society for Immunology

RESOURCES